Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FlpA in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_1045
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5.8
Sequence: TTATTGACAGAAATCAATTT
Locus tag: LACR_1042
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)

Position: -76
Score: 6
Sequence: TAATTGATACAAATCAATTT
Locus tag: LACR_1043
Name: copZ
Funciton: Copper chaperone
Locus tag: LACR_1044
Name: dps
Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Locus tag: LACR_1045
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
copZ
Copper chaperone
dps
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
flpA
Heavy metal resistance transcriptional regulator FlpA, Crp family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD