Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TreR (RgrA) in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_0480
Regulator family: GntR/Others
Regulation mode:
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Regulog: TreR (RgrA) - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 7.2
Sequence: TTAACTTGTACGTACAACTGCA
Locus tag: LACR_0481
Name: treP
Funciton: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
Locus tag: LACR_0482
Name: treP
Funciton: Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
Locus tag: LACR_0483
Name: trePP
Funciton: Trehalose 6-phosphate phosphorylase (EC 2.4.1.216)
Locus tag: LACR_0484
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
treP
Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
treP
Trehalose-specific PTS, IIBC component (EC 2.7.1.69)
trePP
Trehalose 6-phosphate phosphorylase (EC 2.4.1.216)
pgmB
Beta-phosphoglucomutase (EC 5.4.2.6)

Position: -108
Score: 7.2
Sequence: TGCAGTTGTACGTACAAGTTAA
Locus tag: LACR_0480
Name: treR
Funciton: Trehalose utilization transcriptional regulator RgrA, GntR family
treR
Trehalose utilization transcriptional regulator RgrA, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD