Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Oenococcus oeni PSU-1

Properties
Regulator type: Transcription factor
TF locus tag: OEOE_0513
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -71
Score: 6.5
Sequence: AAATGTTTGACCAATCTTGACTAT
Locus tag: OEOE_1310
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: OEOE_1309
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: OEOE_1308
Name: dnaJ
Funciton: Chaperone protein DnaJ
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -21
Score: -0.9
Sequence: TTAGTCAGGAATGGTCAAATTATG
Locus tag: OEOE_0513
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: OEOE_0514
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -27
Score: -1.3
Sequence: AAGGTCAATAAAGGTCAAACATTG
Locus tag: OEOE_0640
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE

Position: -96
Score: 6.5
Sequence: TTTTATTTGACCTTTCTTGACTTT
Locus tag: OEOE_0289
Name: hsp
Funciton: Small heat shock protein
hsp
Small heat shock protein

Position: -63
Score: 6.7
Sequence: AAAAGTTTGACCTTTCTTGACCAT
Locus tag: OEOE_0570
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -72
Score: 6.7
Sequence: AAAAGTTTGACCTTTTTTGACCAA
Locus tag: OEOE_1397
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: OEOE_1396
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD