Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type: Transcription factor
TF locus tag: LSL_0195
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -101
Score: 6.3
Sequence: TTAAATTTGACCATTATTGACCTT
Locus tag: LSL_1168
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -42
Score: -1
Sequence: AAAGTCAATGTAGGTCAAACCTAC
Locus tag: LSL_0195
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LSL_0196
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -75
Score: -1
Sequence: AAGGTCAAACTTAGTCAAAGTTTA
Locus tag: LSL_0863
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB
ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones

Position: -57
Score: -1.6
Sequence: AAGGTCAAAGTTGGTCAAAATAAC
Locus tag: LSL_0386
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD