Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type: Transcription factor
TF locus tag: LSA1780
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -116
Score: 6
Sequence: TACCATTTGACCATAGTTGACCTT
Locus tag: LSA0531
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -89
Score: 6.5
Sequence: GAATGTTTGACCTATTTTGACTAT
Locus tag: LSA1040
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB
ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones

Position: -87
Score: 5.3
Sequence: CAATTCTTGACTTTATTTGACGTT
Locus tag: LSA1238
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LSA1237
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LSA1236
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LSA1235
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -77
Score: -0.8
Sequence: ATAGTCAACGTTAGTCAAAGTTAA
Locus tag: LSA1780
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: LSA1779
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -66
Score: -1.8
Sequence: AAGGTCAAAGATAGTCAAACAAAC
Locus tag: LSA1465
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD