Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_1405
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Lactobacillaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -101
Score: 6.5
Sequence: AATTGTTTGACGTTTCTTGACTTT
Locus tag: LAR_0677
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: LAR_0678
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: LAR_0679
Name: dnaK
Funciton: Chaperone protein DnaK
Locus tag: LAR_0680
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK
dnaJ
Chaperone protein DnaJ

Position: -93
Score: 6.7
Sequence: AAACATTTGACCTTTTTTGACCAA
Locus tag: LAR_0379
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -128
Score: -1.1
Sequence: ATGGTCAAAAAAAGTCAAAGTGTT
Locus tag: LAR_0342
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: LAR_0343
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -59
Score: 0.2
Sequence: ATGGTCAAGAAAGGTCAAAACATT
Locus tag: LAR_1257
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD