Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type: Transcription factor
TF locus tag: str0076
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes 7
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: -0.1
Sequence: TTGGTCAGTAAAAGTCAATTTTTA
Locus tag: str1614
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit

Position: -75
Score: 6.5
Sequence: ATAGATTTGACCTTTTTTGACCAA
Locus tag: str0602
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE

Position: -67
Score: 6.2
Sequence: TTTTATTTGACCTAATTTGACTAA
Locus tag: str0356
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -124
Score: 6.7
Sequence: TTTTTCTTGACTATTTTTGACTAA
Locus tag: str0203
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: str0204
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -38
Score: -0.7
Sequence: ATAGTCAGTTATAGTCAAATTAGA
Locus tag: str0076
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: str0077
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD