Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_1976
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.1
Sequence: TTTTTATTGACCAATTTTGACTAT
Locus tag: SSU05_1551
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Locus tag: SSU05_1550
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -34
Score: -0.9
Sequence: ATGGTCAAAGATAGTCAAAGAAAG
Locus tag: SSU05_1976
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SSU05_1975
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -66
Score: 6.5
Sequence: ATGTTCTTGACTATTTTTGACCAA
Locus tag: SSU05_0147
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SSU05_0148
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: SSU05_0149
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
groL
Heat shock protein 60 family chaperone GroEL

Position: -254
Score: 6.1
Sequence: AAACTATTGACTTTTACTGACCAA
Locus tag: SSU05_0389
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
Locus tag: SSU05_0390
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
Locus tag: SSU05_0391
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD