Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Streptococcus mutans UA159

Properties
Regulator type: Transcription factor
TF locus tag: SMU.2030
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 6.6
Sequence: TAAAGTTTGACCATTATTGACCAT
Locus tag: SMU.562
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE

Position: -91
Score: 6.9
Sequence: TTTTTCTTGACTATTTTTGACCAA
Locus tag: SMU.1955
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SMU.1954
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -68
Score: 6.8
Sequence: AAATATTTGACCTTTTTTGACCAA
Locus tag: SMU.1672
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD