Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Streptococcus agalactiae 2603V/R

Properties
Regulator type: Transcription factor
TF locus tag: SAG1829
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes 7
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.6
Sequence: TATTATTTGACCTTTGTTGACCAA
Locus tag: SAG1585
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)

Position: -65
Score: 6.3
Sequence: TAAAGTTTGACTATATTTGACTAT
Locus tag: SAG0488
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE

Position: -36
Score: -0.7
Sequence: ATAGTCAGTTATAGTCAAAGAGGA
Locus tag: SAG1829
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: SAG1828
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -109
Score: 6.3
Sequence: TTTCTCTTGACTAATTCTGACCAA
Locus tag: SAG2075
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SAG2074
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -144
Score: 6.3
Sequence: TATTTATTGACCTTTACTGACTAA
Locus tag: SAG1303
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD