Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CtsR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type: Transcription factor
TF locus tag: L0223
Regulator family: CtsR
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: CtsR - Streptococcaceae
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 68 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -117
Score: -0.9
Sequence: ATGGTCAAATATGGTCAAACTTTT
Locus tag: L150017
Name: yffA
Funciton: Hypothetical protein
Locus tag: L0221
Name: clpE
Funciton: ATP-dependent Clp protease, ATP-binding subunit ClpE
yffA
Hypothetical protein
clpE
ATP-dependent Clp protease, ATP-binding subunit ClpE

Position: -96
Score: 5.9
Sequence: TTTCTCTTGACTAAATCTGACCAT
Locus tag: L198515
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: L198893
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -56
Score: 0.4
Sequence: ATAGTCAGTAATAGTCAAAGATTA
Locus tag: L0223
Name: ctsR
Funciton: Stress and heat shock response transcriptional regulator CtsR, CtsR family
Locus tag: L0222
Name: clpC
Funciton: ATP-dependent Clp protease ATP-binding subunit ClpC
ctsR
Stress and heat shock response transcriptional regulator CtsR, CtsR family
clpC
ATP-dependent Clp protease ATP-binding subunit ClpC

Position: -98
Score: 6.5
Sequence: AAAAGTTTGACCATTACTGACCAA
Locus tag: L166407
Name: clpB
Funciton: ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones
clpB
ATP-binding subunit of Clp protease and DnaK/DnaJ chaperones

Position: -110
Score: 6.8
Sequence: TATTCTTTGACCTTTTTTGACCAA
Locus tag: L72391
Name: clpP
Funciton: ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
clpP
ATP-dependent Clp protease proteolytic subunit (EC 3.4.21.92)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD