Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FruR in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type: Transcription factor
TF locus tag: SDEG_0811
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Regulog: FruR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 5.7
Sequence: TGGAAGATTATGCTTGACTT
Locus tag: SDEG_0811
Name: fruR
Funciton: Fructose utilization transcriptional regulator FruR, DeoR family
Locus tag: SDEG_0812
Name: fruB
Funciton: 1-phosphofructokinase (EC 2.7.1.56)
Locus tag: SDEG_0813
Name: fruA
Funciton: Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
fruR
Fructose utilization transcriptional regulator FruR, DeoR family
fruB
1-phosphofructokinase (EC 2.7.1.56)
fruA
Fructose-specific PTS, EIIABC component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD