Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MtlR in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB0996
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Regulog: MtlR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -89
Score: 6.7
Sequence: TGTGTCACAGCTTTTGTGCCAAA
Locus tag: SUB0997
Name: mtlA
Funciton: PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
Locus tag: SUB0996
Name: mtlR
Funciton: Mannitol utilization transcription activator MtlR, BglG family
Locus tag: SUB0995
Name: mtlF
Funciton: PTS system, mannitol-specific IIA component (EC 2.7.1.69)
Locus tag: SUB0994
Name: mtlD
Funciton: Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
mtlA
PTS system, mannitol-specific IIB component (EC 2.7.1.69) / PTS system, mannitol-specific IIC component (EC 2.7.1.69)
mtlR
Mannitol utilization transcription activator MtlR, BglG family
mtlF
PTS system, mannitol-specific IIA component (EC 2.7.1.69)
mtlD
Mannitol-1-phosphate 5-dehydrogenase (EC 1.1.1.17)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD