Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB0530
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -141
Score: 4.8
Sequence: TTGCTTTTTTAATAGGGAAA
Position: -100
Score: 6
Sequence: TTTCCGCATCATTACGGAAA
Locus tag: SUB0529
Name: celB
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: SUB0530
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: SUB0531
Name: celA
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SUB0532
Name: PF06570
Funciton: Hypothetical membrane protein, PF06570 family
Locus tag: SUB0533
Name: celD
Funciton: Cellobiose-specific PTS, component EIIC
celB
Cellobiose-specific PTS, component EIIB
celR
Cellobiose utilization transcriptional regulator CelR, BglG family
celA
Cellobiose-specific PTS, component EIIA
PF06570
Hypothetical membrane protein, PF06570 family
celD
Cellobiose-specific PTS, component EIIC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD