Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy1325
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -100
Score: 5.5
Sequence: TTTCACAATCAATGCGGAAA
Locus tag: SPy1325
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: SPy1324
Name: celB2
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: SPy1323
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: SPy1322
Name: PF11687
Funciton: Hypothetical membrane protein, PF11687 family
celR
Cellobiose utilization transcriptional regulator CelR, BglG family
celB2
Cellobiose-specific PTS, component EIIB
celA2
Cellobiose-specific PTS, component EIIA
PF11687
Hypothetical membrane protein, PF11687 family

Position: -102
Score: 5.8
Sequence: TTTCCGTGATGATAAGGAAA
Locus tag: SPy1328
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: SPy1326
Name: celO
Funciton: Predicted outer surface protein
bglA
6-phospho-beta-glucosidase (EC 3.2.1.86)
celO
Predicted outer surface protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD