Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type: Transcription factor
TF locus tag: Sez_1282
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Regulog: CelR - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -97
Score: 5.3
Sequence: CTTCACAATCGATACGGAAA
Locus tag: Sez_1282
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, BglG family
Locus tag: Sez_1281
Name: celB2
Funciton: Cellobiose-specific PTS, component EIIB
Locus tag: Sez_1280
Name: celA2
Funciton: Cellobiose-specific PTS, component EIIA
Locus tag: Sez_1279
Name: PF11687
Funciton: Hypothetical membrane protein, PF11687 family
Locus tag: Sez_1278
Name: celD2
Funciton: Cellobiose-specific PTS, component EIIC
celR
Cellobiose utilization transcriptional regulator CelR, BglG family
celB2
Cellobiose-specific PTS, component EIIB
celA2
Cellobiose-specific PTS, component EIIA
PF11687
Hypothetical membrane protein, PF11687 family
celD2
Cellobiose-specific PTS, component EIIC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD