Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CcpN in Streptococcus sanguinis SK36

Properties
Regulator type: Transcription factor
TF locus tag: SSA_1054
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -124
Score: 5.5
Sequence: TTATAATGTGTTACAAAATGA
Locus tag: SSA_1054
Name: yqfL
Funciton: Predicted phosphotransferase
Locus tag: SSA_1055
Name: ccpN
Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family
Locus tag: SSA_1056
Name: fbp
Funciton: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
yqfL
Predicted phosphotransferase
ccpN
Gluconeogenesis transcriptional regulator CcpN, CcpN family
fbp
Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)

Position: -142
Score: 5.5
Sequence: TCATTTTGTAACACATTATAA
Locus tag: SSA_1053
Name: ppdK
Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
ppdK
Pyruvate phosphate dikinase (EC 2.7.9.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD