Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CcpN in Streptococcus agalactiae 2603V/R

Properties
Regulator type: Transcription factor
TF locus tag: SAG1672
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Regulog: CcpN - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -171
Score: 5.7
Sequence: ATATAATATAACATATAAAAT
Locus tag: SAG1672
Name: yqfL
Funciton: Predicted phosphotransferase
Locus tag: SAG1671
Name: ccpN
Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family
Locus tag: SAG1670
Name: ppdK
Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
yqfL
Predicted phosphotransferase
ccpN
Gluconeogenesis transcriptional regulator CcpN, CcpN family
ppdK
Pyruvate phosphate dikinase (EC 2.7.9.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD