Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LACR_0766 in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type: Transcription factor
TF locus tag: SDEG_1904
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: LACR_0766 - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -232
Score: 5.8
Sequence: TAGGTTTATCGTTAAACTAT
Locus tag: SDEG_1904
Name: LACR_0766
Funciton: Predicted sugar utilization transcriptional regulator, LacI family
LACR_0766
Predicted sugar utilization transcriptional regulator, LacI family

Position: -121
Score: 6.3
Sequence: TCGGTTTAACGATAAACTAA
Locus tag: SDEG_1903
Name: LACR_0761
Funciton: Predicted polysaccharide ABC transporter, permease protein 1
Locus tag: SDEG_1902
Name: LACR_0762
Funciton: Predicted polysaccharide ABC transporter, permease protein 2
Locus tag: SDEG_1901
Name: LACR_0764
Funciton: Predicted integral membrane protein
Locus tag: SDEG_1900
Name: LACR_0763
Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein
LACR_0761
Predicted polysaccharide ABC transporter, permease protein 1
LACR_0762
Predicted polysaccharide ABC transporter, permease protein 2
LACR_0764
Predicted integral membrane protein
LACR_0763
Predicted polysaccharide ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD