Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SdaR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0411
Regulator family: SdaR
Regulation mode: repressor
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -190
Score: 4.8
Sequence: AATTGATCAATGTAACTATG
Locus tag: LVIS_0411
Name: sdaR
Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
sdaR
Glycerate utilization transcriptional regulator SdaR, SdaR family

Position: -123
Score: 4.8
Sequence: CATAGTTACATTGATCAATT
Locus tag: LVIS_0412
Name: grtP
Funciton: D-glycerate transporter, GntP family
Locus tag: LVIS_0413
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
grtP
D-glycerate transporter, GntP family
garK
Glycerate kinase (EC 2.7.1.31)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD