Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelQ in Streptococcus sanguinis SK36

Properties
Regulator type: Transcription factor
TF locus tag: SSA_0267
Regulator family: ROK
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelQ - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -156
Score: 6.5
Sequence: TTTATTTTCAATATATAAACAAA
Locus tag: SSA_0267
Name: celQ
Funciton: Predicted cellobiose utilization transcriptional regulator, ROK family
celQ
Predicted cellobiose utilization transcriptional regulator, ROK family

Position: -71
Score: 6.5
Sequence: TTTGTTTATATATTGAAAATAAA
Locus tag: SSA_0268
Name: celD2
Funciton: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: SSA_0269
Name: celA2
Funciton: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
Locus tag: SSA_0270
Name: celC2
Funciton: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
Locus tag: SSA_0271
Name: lacZ
Funciton: Beta-galactosidase (EC 3.2.1.23)
celD2
Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
celA2
Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
celC2
Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
lacZ
Beta-galactosidase (EC 3.2.1.23)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD