Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CelQ in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type: Transcription factor
TF locus tag: Sez_1431
Regulator family: ROK
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Regulog: CelQ - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -164
Score: 5.9
Sequence: TTTATTTTAAAAATATTAACAAA
Position: -118
Score: 6.6
Sequence: TTTGTTTACTTTTTATAAACAAA
Locus tag: Sez_1431
Name: celQ
Funciton: Predicted cellobiose utilization transcriptional regulator, ROK family
celQ
Predicted cellobiose utilization transcriptional regulator, ROK family

Position: -84
Score: 6.6
Sequence: TTTGTTTATAAAAAGTAAACAAA
Position: -38
Score: 5.9
Sequence: TTTGTTAATATTTTTAAAATAAA
Locus tag: Sez_1430
Name: Sez_1430
Funciton: Conserved hypothetical protein
Locus tag: Sez_1429
Name: celD2
Funciton: Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: Sez_1428
Name: celA2
Funciton: Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
Locus tag: Sez_1427
Name: celB2
Funciton: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
Locus tag: Sez_1426
Name: celC2
Funciton: Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
Sez_1430
Conserved hypothetical protein
celD2
Cellobiose-specific PTS system, EIIB component (EC 2.7.1.69)
celA2
Cellobiose-specific PTS system, EIIA component (EC 2.7.1.69)
celB2
Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
celC2
Cellobiose-specific PTS system, EIIC component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD