Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SAG1808 in Streptococcus sanguinis SK36

Properties
Regulator type: Transcription factor
TF locus tag: SSA_2087
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: SAG1808 - Streptococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -77
Score: 5.9
Sequence: TAAGTTAACCGCTTCGCCCA
Locus tag: SSA_2086
Name: SAG1807
Funciton: Conserved hypothetical protein
Locus tag: SSA_2085
Name: PF00389
Funciton: D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
Locus tag: SSA_2084
Name: SAG1805
Funciton: Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
Locus tag: SSA_2083
Name: SAG1804
Funciton: Conserved hypothetical protein
Locus tag: SSA_2082
Name: SAG1803
Funciton: Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase
SAG1807
Conserved hypothetical protein
PF00389
D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain
SAG1805
Predicted sugar PTS, EIIC component (EC 2.7.1.69), similar to galactitol PTS
SAG1804
Conserved hypothetical protein
SAG1803
Predicted carbohydrate kinase, FGGY family, similar to L-xylulose kinase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD