Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AlsR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag: LACR_1640
Regulator family: LacI
Regulation mode: repressor
Biological process: Allose utilization
Effector: Allose-6-phosphate
Regulog: AlsR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -182
Score: 6.5
Sequence: TTGAGATAACGATTACCCAA
Locus tag: LACR_1640
Name: alsR
Funciton: Transcriptional regulator of D-allose utilization, LacI family
alsR
Transcriptional regulator of D-allose utilization, LacI family

Position: -31
Score: 6.5
Sequence: TTGGGTAATCGTTATCTCAA
Locus tag: LACR_1639
Name: alsE
Funciton: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
Locus tag: LACR_1638
Name: alsI
Funciton: D-allose-6-phosphate isomerase (EC 5.3.1.-)
Locus tag: LACR_1637
Name: bglH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
alsE
D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
alsI
D-allose-6-phosphate isomerase (EC 5.3.1.-)
bglH
6-phospho-beta-glucosidase (EC 3.2.1.86)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD