Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MdxR in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_2066
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MdxR - Streptococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -78
Score: 6.4
Sequence: TAAAGAAAACGTTTGCACAA
Locus tag: SSU05_2066
Name: mdxR
Funciton: Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family
Locus tag: SSU05_2065
Name: pulA
Funciton: Pullulanase (EC 3.2.1.41)
Locus tag: SSU05_2064
Name: pulA
Funciton: Pullulanase (EC 3.2.1.41)
mdxR
Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family
pulA
Pullulanase (EC 3.2.1.41)
pulA
Pullulanase (EC 3.2.1.41)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD