Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NigR in Streptococcus mutans UA159

Properties
Regulator type: Transcription factor
TF locus tag: SMU.105
Regulator family: LacI
Regulation mode: repressor
Biological process: Nigerose utilization
Effector: Nigerose-6-phosphate
Regulog: NigR - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -102
Score: 5.8
Sequence: AATATGGAACGTTCCATGTA
Position: -37
Score: 4.7
Sequence: GAAATTGAACGTTCAATATT
Locus tag: SMU.100
Name: nigB
Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: SMU.101
Name: nigC
Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: SMU.102
Name: nigD
Funciton: Nigerose-specific PTS system, EIID component
Locus tag: SMU.103
Name: nigA
Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: SMU.104
Name: nigE
Funciton: Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase
Locus tag: SMU.105
Name: nigR
Funciton: Nigerose utilization repressor, LacI family
nigB
Nigerose-specific PTS system, EIIB component
nigC
Nigerose-specific PTS system, EIIC component
nigD
Nigerose-specific PTS system, EIID component
nigA
Nigerose-specific PTS system, EIIA component
nigE
Cytoplasmic alpha-glucosidase, family 31 of glycosyl hydrolase
nigR
Nigerose utilization repressor, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD