Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR2 in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy1297
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR2 - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -141
Score: 7.3
Sequence: TAACTTAAACGTTTAAGTTT
Locus tag: SPy1306
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: SPy1304
Name: amyB
Funciton: Neopullulanase (EC 3.2.1.135)
Locus tag: SPy1302
Name: amyA
Funciton: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
Locus tag: SPy1301
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: SPy1299
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: SPy1298
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX
Maltose/maltodextrin ABC transporter, substrate-binding protein
amyB
Neopullulanase (EC 3.2.1.135)
amyA
Cyclodextrin glucanotransferase( EC:2.4.1.19 )
malC
Maltose/maltodextrin ABC transporter, permease protein 1
malD
Maltose/maltodextrin ABC transporter, permease protein 2
malA
Maltodextrose utilization protein MalA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD