Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MalR2 in Streptococcus gallolyticus UCN34

Properties
Regulator type: Transcription factor
TF locus tag: GALLO_0752
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Regulog: MalR2 - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 7.6
Sequence: TAACTTAAACGTTTAAGTTA
Locus tag: GALLO_0751
Name: GALLO_0751
Funciton: Putative secreted protein
GALLO_0751
Putative secreted protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD