Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur2 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_3895
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur2 - Chloroflexia
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -63
Score: 5
Sequence: TCGTTGAAAGTAACTATCATCTG
Locus tag: Rcas_3893
Name: Rcas_3893
Funciton: hypothetical protein
Rcas_3893
hypothetical protein

Position: -50
Score: 6.1
Sequence: CAAGTGATAGCATATATCACAAA
Locus tag: Rcas_2948
Name: fmdB
Funciton: putative regulatory protein, FmdB family
Locus tag: Rcas_2949
Name: yciC2
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
fmdB
putative regulatory protein, FmdB family
yciC2
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -59
Score: 5.6
Sequence: TCATTGATATACACTATCATCAA
Locus tag: Rcas_2945
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -157
Score: 5.6
Sequence: CAACTGATAGATAAGATCATTTG
Locus tag: Rcas_3900
Name: Rcas_3900
Funciton: Zinc finger domain, similar to cold shock proteins
Rcas_3900
Zinc finger domain, similar to cold shock proteins

Position: -33
Score: 7
Sequence: TAAGTGATAGTAACTATCATTTA
Locus tag: Rcas_3894
Name: COG0701
Funciton: predicted permease
COG0701
predicted permease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD