Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HomR in Streptococcus thermophilus CNRZ1066

Properties
Regulator type: Transcription factor
TF locus tag: str0452
Regulator family: LysR
Regulation mode: activator
Biological process: Methionine metabolism; Cysteine metabolism
Effector: O-acetyl-L-serine
Regulog: HomR - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 4.6
Sequence: GATATAGTTTAAAACTATATA
Locus tag: str0785
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: str0786
Name: metF
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metE
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metF
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -132
Score: 5.4
Sequence: GTTATAGTAATAAACTATATC
Locus tag: str0352
Name: metB
Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: str0353
Name: metC
Funciton: L-cysteine desulfhydrase
metB
Cystathionine gamma-synthase (EC 2.5.1.48)
metC
L-cysteine desulfhydrase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD