Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HomR in Streptococcus mutans UA159

Properties
Regulator type: Transcription factor
TF locus tag: SMU.930c
Regulator family: LysR
Regulation mode: activator
Biological process: Methionine metabolism; Cysteine metabolism
Effector: O-acetyl-L-serine
Regulog: HomR - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -188
Score: 5.4
Sequence: GTTATAGATGAAAACTATAAC
Locus tag: SMU.873
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
Locus tag: SMU.874
Name: metH
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metE
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metH
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -168
Score: 5.2
Sequence: GTGATAACTTTTTCTTATGGC
Position: -103
Score: 6.1
Sequence: GTCATAAATAAAATTTATAGC
Locus tag: SMU.932
Name: tcyD
Funciton: Predicted uroporphyrinogen-III decarboxylase
Locus tag: SMU.933
Name: tcyE
Funciton: Predicted cysteine ABC transporter, substrate-binding protein
Locus tag: SMU.934
Name: tcyF
Funciton: Predicted cysteine ABC transporter, permease protein 1
Locus tag: SMU.935
Name: tcyG
Funciton: Predicted cysteine ABC transporter, permease protein 2
Locus tag: SMU.936
Name: tcyH
Funciton: Predicted cysteine ABC transporter, ATP-binding protein
tcyD
Predicted uroporphyrinogen-III decarboxylase
tcyE
Predicted cysteine ABC transporter, substrate-binding protein
tcyF
Predicted cysteine ABC transporter, permease protein 1
tcyG
Predicted cysteine ABC transporter, permease protein 2
tcyH
Predicted cysteine ABC transporter, ATP-binding protein

Position: -175
Score: 6.1
Sequence: GCTATAAATTTTATTTATGAC
Position: -110
Score: 5.2
Sequence: GCCATAAGAAAAAGTTATCAC
Locus tag: SMU.930c
Name: GALLO_1277
Funciton: Homocysteine biosynthesis transcriptional regulator HomR, LysR family
GALLO_1277
Homocysteine biosynthesis transcriptional regulator HomR, LysR family

Position: -110
Score: 4.9
Sequence: CTTATAGTTTCTTTTTATAGC
Locus tag: SMU.1675
Name: metB
Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: SMU.1674
Name: metC
Funciton: L-cysteine desulfhydrase
metB
Cystathionine gamma-synthase (EC 2.5.1.48)
metC
L-cysteine desulfhydrase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD