Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HomR in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: LysR
Regulation mode: activator
Biological process: Methionine metabolism; Cysteine metabolism
Effector: O-acetyl-L-serine
Regulog: HomR - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 4.8
Sequence: GACATAGCATTTTCTTATGGC
Locus tag: LACR_0831
Name: metB2
Funciton: Cystathionine gamma-lyase (EC 4.4.1.1)
metB2
Cystathionine gamma-lyase (EC 4.4.1.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD