Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RbsR2 in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy1535
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR2 - Streptococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -367
Score: 3.7
Sequence: CATAAAAAACGGTTGAACCA
Locus tag: SPy1535
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family
rbsR2
Transcriptional repressor of ribose utilization RbsR2, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD