Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RegR in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_1210
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Statistics of regulated genes:
- Genes 14
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -75
Score: 5.8
Sequence: TGACAAAACCGGTTTACTAT
Locus tag: SSU05_1225
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: SSU05_1224
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: SSU05_1223
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: SSU05_1222
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kduD
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)

Position: -33
Score: 4.9
Sequence: TAGGTAAACCGGTAAAGTTA
Locus tag: SSU05_1221
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SSU05_1220
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SSU05_1219
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SSU05_1218
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SSU05_1217
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SSU05_1216
Name: yajC
Funciton: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
Locus tag: SSU05_1215
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1214
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1213
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
Locus tag: SSU05_1212
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hylD
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
yajC
Preprotein translocase subunit YajC (TC 3.A.5.1.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD