Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RegR in Streptococcus pyogenes M1 GAS

Properties
Regulator type: Transcription factor
TF locus tag: SPy0627
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Statistics of regulated genes:
- Genes 12
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5.5
Sequence: TTAGTAAATCAATTTACTTT
Locus tag: SPy1032
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)

Position: -281
Score: 5.1
Sequence: AAAGTAAACTAGTTTTGTCA
Position: -33
Score: 4.6
Sequence: TGAGTAAACCGGTAAACCGA
Locus tag: SPy0634
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SPy0632
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SPy0631
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SPy0630
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SPy0629
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SPy0628
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SPy0627
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
ohl
Oligohyaluronate lyase (EC 4.2.2.-)
regR
Transcriptional regulator of hyaluronate and KDG utilization, LacI family

Position: -74
Score: 5.1
Sequence: TGACAAAACTAGTTTACTTT
Position: -45
Score: 6.1
Sequence: TTGGTAAACAGGTTTACTTA
Locus tag: SPy0636
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: SPy0637
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: SPy0638
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: SPy0639
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kduD
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD