Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RegR in Streptococcus pneumoniae TIGR4

Properties
Regulator type: Transcription factor
TF locus tag: SP_0330
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Statistics of regulated genes:
- Genes 15
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -253
Score: 5
Sequence: TAGGTTTACCGGTTTACTTT
Position: -71
Score: 5.6
Sequence: TGACAAAACCGGTTTACTAG
Locus tag: SP_0320
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: SP_0319
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: SP_0318
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: SP_0317
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kduD
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)

Position: -219
Score: 5.6
Sequence: CTAGTAAACCGGTTTTGTCA
Position: -37
Score: 5
Sequence: AAAGTAAACCGGTAAACCTA
Locus tag: SP_0321
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SP_0322
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SP_0323
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SP_0324
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SP_0325
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SP_0326
Name: yajC
Funciton: Preprotein translocase subunit YajC (TC 3.A.5.1.1)
Locus tag: SP_0327
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SP_0328
Name: null
Funciton: IS1380-Spn1, transposase
Locus tag: SP_0329
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SP_0330
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
yajC
Preprotein translocase subunit YajC (TC 3.A.5.1.1)
ohl
Oligohyaluronate lyase (EC 4.2.2.-)
IS1380-Spn1, transposase
ohl
Oligohyaluronate lyase (EC 4.2.2.-)
regR
Transcriptional regulator of hyaluronate and KDG utilization, LacI family

Position: -89
Score: 6.2
Sequence: TAATTAAACCGGTTTACTTA
Locus tag: SP_0314
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD