Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RegR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type: Transcription factor
TF locus tag: Sez_1309
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -293
Score: 5.3
Sequence: TTAGTTTACCGGTTTACTTA
Position: -45
Score: 6.1
Sequence: TTGGTAAACAGGTTTACTTA
Locus tag: Sez_1303
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: Sez_1302
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: Sez_1301
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: Sez_1300
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
Locus tag: Sez_1299
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
kduD
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)

Position: -281
Score: 6.1
Sequence: TAAGTAAACCTGTTTACCAA
Position: -33
Score: 5.3
Sequence: TAAGTAAACCGGTAAACTAA
Locus tag: Sez_1304
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: Sez_1305
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: Sez_1306
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: Sez_1307
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: Sez_1308
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
hylD
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD