Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RegR in Streptococcus agalactiae 2603V/R

Properties
Regulator type: Transcription factor
TF locus tag: SAG1896
Regulator family: LacI
Regulation mode: repressor
Biological process: Hyaluronate utilization
Effector: Hyaluronate oligosaccharide phosphate
Regulog: RegR - Streptococcaceae
Statistics of regulated genes:
- Genes 12
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5
Sequence: AGGAAAAACCGGTTTACAAT
Locus tag: SAG1197
Name: hyl
Funciton: Hyaluronate lyase precursor (EC 4.2.2.1)
hyl
Hyaluronate lyase precursor (EC 4.2.2.1)

Position: -265
Score: 5.1
Sequence: TGAGTTTACCGGTTTACTTT
Position: -75
Score: 5.9
Sequence: TGACAAAACCGGTTTACTTT
Position: -46
Score: 5.1
Sequence: CATGTAAACAGGTTTACTTC
Locus tag: SAG1904
Name: kduD
Funciton: 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
Locus tag: SAG1905
Name: kduI
Funciton: 5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
Locus tag: SAG1906
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Locus tag: SAG1907
Name: kdgA
Funciton: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
kduD
2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase (EC 1.1.1.127)
kduI
5-keto-4-deoxyuronate isomerase (EC 5.3.1.17)
kdgK
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
kdgA
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)

Position: -251
Score: 5.1
Sequence: GAAGTAAACCTGTTTACATG
Position: -222
Score: 5.9
Sequence: AAAGTAAACCGGTTTTGTCA
Position: -32
Score: 5.1
Sequence: AAAGTAAACCGGTAAACTCA
Locus tag: SAG1902
Name: hylD
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
Locus tag: SAG1901
Name: ugl
Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
Locus tag: SAG1900
Name: hylE
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
Locus tag: SAG1899
Name: hylF
Funciton: PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
Locus tag: SAG1898
Name: hylG
Funciton: PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
Locus tag: SAG1897
Name: ohl
Funciton: Oligohyaluronate lyase (EC 4.2.2.-)
Locus tag: SAG1896
Name: regR
Funciton: Transcriptional regulator of hyaluronate and KDG utilization, LacI family
hylD
PTS system, hyaluronate-oligosaccharide-specific IIA component (EC 2.7.1.69)
ugl
Unsaturated glucuronyl hydrolase (EC 3.2.1.-)
hylE
PTS system, hyaluronate-oligosaccharide-specific IIB component (EC 2.7.1.69)
hylF
PTS system, hyaluronate-oligosaccharide-specific IIC component (EC 2.7.1.69)
hylG
PTS system, hyaluronate-oligosaccharide-specific IID component (EC 2.7.1.69)
ohl
Oligohyaluronate lyase (EC 4.2.2.-)
regR
Transcriptional regulator of hyaluronate and KDG utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD