Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur2 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_3389
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur2 - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -98
Score: 6.1
Sequence: TTTTTCATGGGCCAGATGATAGT
Locus tag: Veis_3389
Name: zur2
Funciton: Zinc uptake regulation protein Zur
zur2
Zinc uptake regulation protein Zur

Position: -143
Score: 6.1
Sequence: ACTATCATCTGGCCCATGAAAAA
Locus tag: Veis_3390
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Veis_3391
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Veis_3392
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD