Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Roseobacter sp. MED193

Properties
Regulator type: Transcription factor
TF locus tag: MED193_17324
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Rhodobacterales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -114
Score: 6.7
Sequence: ATAAACCGACCGGACGGTCAAT
Locus tag: MED193_17304
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: MED193_17299
Name: paaX
Funciton: Phenylacetic acid degradation operon negative regulatory protein paaX
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaX
Phenylacetic acid degradation operon negative regulatory protein paaX

Position: -95
Score: 6.7
Sequence: ATTGACCGTCCGGTCGGTTTAT
Locus tag: MED193_17309
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: MED193_17314
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: MED193_17319
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: MED193_17324
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
thioesterase superfamily protein
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD