Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Rhizobium sp. NGR234

Properties
Regulator type: Transcription factor
TF locus tag: NGR_c26120
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Rhizobiales
Statistics of regulated genes:
- Genes 13
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 6.5
Sequence: ATTGACTGACCGGTCGGTTTAT
Locus tag: NGR_c26090
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: NGR_c26100
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: NGR_c26110
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: NGR_c26120
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
thioesterase superfamily protein
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family

Position: -53
Score: 5.7
Sequence: TCTGACCGATCGGTCGGTTAAT
Locus tag: NGR_c26200
Name: blr2890
Funciton: putative beta-ketoadipyl CoA thiolase
Locus tag: NGR_c26190
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: NGR_c26180
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: NGR_c26170
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: NGR_c26160
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: NGR_c26150
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: NGR_c26140
Name: null
Funciton: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
Locus tag: NGR_c26130
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
blr2890
putative beta-ketoadipyl CoA thiolase
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Position: -51
Score: 6.5
Sequence: ATAAACCGACCGGTCAGTCAAT
Locus tag: NGR_c26080
Name: paaG
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
paaG
Enoyl-CoA hydratase (EC 4.2.1.17)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD