Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_3950
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes 12
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -102
Score: 5.5
Sequence: ATCTACCGCACGGTCGGTCAAT
Locus tag: Veis_3942
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Veis_3943
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Veis_3944
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Veis_3945
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Veis_3946
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Veis_3947
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Veis_3948
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Veis_3949
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Veis_3950
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Veis_3951
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Veis_3952
Name: livH
Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Veis_3953
Name: livM
Funciton: Putative branched-chain amino acid ABC transporter, ATPase component
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
thioesterase superfamily protein
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family
livK
Putative branched-chain amino acid ABC transporter, substrate-binding component
livH
Putative branched-chain amino acid ABC transporter, permease component
livM
Putative branched-chain amino acid ABC transporter, ATPase component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD