Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A0992
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 5.7
Sequence: GTCTACCGACTGGTCGGTCAAT
Locus tag: Mpe_A0984
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Mpe_A0985
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Mpe_A0986
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Mpe_A0987
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Mpe_A0988
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Mpe_A0989
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Mpe_A0990
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Mpe_A0991
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Mpe_A0992
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
thioesterase superfamily protein
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family

Position: -78
Score: 5.6
Sequence: ATTGACCGACCAGTCGGTAGAC
Locus tag: Mpe_A0983
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
paaY2
phenylacetic acid degradation protein PaaY
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD