Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Leptothrix cholodnii SP-6

Properties
Regulator type: Transcription factor
TF locus tag: Lcho_2402
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Comamonadaceae
Statistics of regulated genes:
- Genes 13
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -115
Score: 5.5
Sequence: CTTGACCGACCGGTAGGTAAAT
Locus tag: Lcho_2406
Name: paaY2
Funciton: phenylacetic acid degradation protein PaaY
paaY2
phenylacetic acid degradation protein PaaY

Position: -42
Score: 5.8
Sequence: ATTTACCTACCGGTCGGTCAAG
Locus tag: Lcho_2405
Name: paaF
Funciton: Enoyl-CoA hydratase (EC 4.2.1.17)
Locus tag: Lcho_2404
Name: paaY
Funciton: thioesterase superfamily protein
Locus tag: Lcho_2403
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: Lcho_2402
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Lcho_2401
Name: livK
Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
paaF
Enoyl-CoA hydratase (EC 4.2.1.17)
paaY
thioesterase superfamily protein
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family
livK
Putative branched-chain amino acid ABC transporter, substrate-binding component

Position: -48
Score: 6.3
Sequence: ATTTACCGACCGGACGGTCAAT
Locus tag: Lcho_3574
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Lcho_3573
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Lcho_3572
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Lcho_3571
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Lcho_3570
Name: null
Funciton: hypothetical protein
Locus tag: Lcho_3569
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Lcho_3568
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
hypothetical protein
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD