Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of UxuR in Paenibacillus sp. JDR-2

Properties
Regulator type: Transcription factor
TF locus tag: Pjdr2_0332
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Regulog: UxuR - Bacillales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -53
Score: 4.7
Sequence: CAAGAATACAAGTAAAGTAA
Locus tag: Pjdr2_0332
Name: uxuR
Funciton: Transcriptional regulator of glucuronate utilization, GntR family
Locus tag: Pjdr2_0333
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: Pjdr2_0334
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
uxuR
Transcriptional regulator of glucuronate utilization, GntR family
uxuA
Mannonate dehydratase (EC 4.2.1.8)
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD