Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of UxuR in Bacillus licheniformis DSM 13

Properties
Regulator type: Transcription factor
TF locus tag: BLi01354
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Regulog: UxuR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 6
Sequence: CAGCCATACTTGTATGGTAG
Locus tag: BLi01354
Name: uxuR
Funciton: Transcriptional regulator of glucuronate utilization, GntR family
Locus tag: BLi01355
Name: uxmD
Funciton: Predicted mannuronate dehydrogenase (EC 1.1.1.131)
Locus tag: BLi01356
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: BLi01357
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: BLi01358
Name: yjmD2
Funciton: Oxidoreductase, zinc-binding dehydrogenase family (EC 1.1.1.-)
Locus tag: BLi01359
Name: exuT
Funciton: Hexuronate transporter
uxuR
Transcriptional regulator of glucuronate utilization, GntR family
uxmD
Predicted mannuronate dehydrogenase (EC 1.1.1.131)
uxuA
Mannonate dehydratase (EC 4.2.1.8)
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)
yjmD2
Oxidoreductase, zinc-binding dehydrogenase family (EC 1.1.1.-)
exuT
Hexuronate transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD