Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of UxuR in Bacillus halodurans C-125

Properties
Regulator type: Transcription factor
TF locus tag: BH1062
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Regulog: UxuR - Bacillales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -186
Score: 6.1
Sequence: CTACCATACTAGTATGATTA
Locus tag: BH1064
Name: BH1064
Funciton: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
Locus tag: BH1065
Name: BH1065
Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1066
Name: BH1066
Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1067
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: BH1068
Name: xynB
Funciton: Beta-xylosidase
BH1064
Putative aldotetraouronic acid ABC transporter, substrate-binding protein
BH1065
Putative aldotetraouronic acid ABC transporter, permease component
BH1066
Putative aldotetraouronic acid ABC transporter, permease component
uxuB
D-mannonate oxidoreductase (EC 1.1.1.57)
xynB
Beta-xylosidase

Position: -45
Score: 5.6
Sequence: TATGTATACTAGTATGGTTA
Locus tag: BH1063
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
uxuA
Mannonate dehydratase (EC 4.2.1.8)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD