Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Streptococcus uberis 0140J

Properties
Regulator type: Transcription factor
TF locus tag: SUB1506
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -45
Score: 7.1
Sequence: TTAGCAGTCTTAGCATCAGAGTGCTAA
Locus tag: SUB1506
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: SUB1505
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: SUB1504
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK

Position: -63
Score: 7.5
Sequence: TTGGCACTCTTTTTTAAAGAGTGCTAA
Locus tag: SUB1742
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SUB1741
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -140
Score: 6
Sequence: TTATCACTCTAAGTCACTAAGTGCTAA
Locus tag: SUB1281
Name: clpL
Funciton: ATP-dependent Clp protease, ATP-binding subunit
clpL
ATP-dependent Clp protease, ATP-binding subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD