Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Streptococcus suis 05ZYH33

Properties
Regulator type: Transcription factor
TF locus tag: SSU05_0298
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -226
Score: 7.8
Sequence: TTAGCACTCTAAGCAAAAGAGTGCTAA
Position: -140
Score: 7.4
Sequence: TTAGCACTCGATATCATAGAGTGCTAA
Locus tag: SSU05_0298
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: SSU05_0299
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: SSU05_0300
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE
dnaK
Chaperone protein DnaK

Position: -20
Score: 7.7
Sequence: TTAGCACTCGAATACAAAGAGTGCTAA
Locus tag: SSU05_0147
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SSU05_0148
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
Locus tag: SSU05_0149
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD