Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Streptococcus pneumoniae TIGR4

Properties
Regulator type: Transcription factor
TF locus tag: SP_0515
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 49 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 7.8
Sequence: TTAGCACTCTTGATAAAAGAGTGCTAA
Position: -53
Score: 6.5
Sequence: TTAGCACTTGGATGCATTGAGTGCTAA
Locus tag: SP_0515
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: SP_0516
Name: grpE
Funciton: Heat shock protein GrpE
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
Heat shock protein GrpE

Position: -57
Score: 7.6
Sequence: TTAGCACTCAAGTTCAAAGAGTGCTAA
Locus tag: SP_1907
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SP_1906
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD